After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек HHIP Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human HHIP Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_022475.2
Размер кДНК:2103bp
Описание кДНК:Full length Clone DNA of Homo sapiens hedgehog interacting protein with Flag tag.
Синоним гена:HIP, HHIP
Виды:Human
переносчик:pCMV/hygro-FLAG
Plasmid:pCMV-HHIP-flag
Участок рестрикции:KpnI + XhoI (5.5kb + 2.13kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref.ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human HHIP Gene Plasmid Map
Human HHIP Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
 
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек HHIP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13798-ACGRBS16760
Человек HHIP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13798-ACRRBS16760
Человек HHIP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13798-CFRBS14710
Человек HHIP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13798-CHRBS14710
Человек HHIP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13798-CMRBS14710
Человек HHIP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13798-CYRBS14710
Человек HHIP Джин клон кДНК в вектор клонированияHG13798-GRBS5130
Человек HHIP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13798-G-HRBS14710
Человек HHIP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13798-NFRBS14710
Человек HHIP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13798-NHRBS14710
Человек HHIP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13798-NMRBS14710
Человек HHIP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13798-NYRBS14710
Человек HHIP Джин ORF экспрессии кДНК клона плазмидыHG13798-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».