Быстрый заказ

Хорек UCP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Хорек UCP2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:XM_004768075.1
    Размер кДНК:930bp
    Описание кДНК:Full length Clone DNA of Mustela putorius furo (sub-species: furo) uncoupling protein 2 (mitochondrial, proton carrier) with N terminal HA tag.
    Синоним гена:UCP2
    Виды:Ferret
    переносчик:pCMV3-SP-N-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Хорек UCP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
    Хорек UCP2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60053-ACGRBS15400
    Хорек UCP2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60053-ACRRBS15400
    Хорек UCP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60053-CFRBS13340
    Хорек UCP2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60053-CHRBS13340
    Хорек UCP2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60053-CMRBS13340
    Хорек UCP2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60053-CYRBS13340
    Хорек UCP2 Джин клон кДНК в вектор клонированияFG60053-GRBS5130
    Хорек UCP2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60053-NFRBS13340
    Хорек UCP2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60053-NHRBS13340
    Хорек UCP2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60053-NMRBS13340
    Хорек UCP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60053-NYRBS13340
    Хорек UCP2 Джин ORF экспрессии кДНК клона плазмидыFG60053-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: FG60053-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».