Быстрый заказ

Text Size:AAA

Хорек TREM-1/TREM1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Ferret TREM1 Информация о продукте «Клон cDNA»
Размер кДНК:615bp
Описание кДНК:Full length Clone DNA of Mustela putorius furo (sub-species: furo) triggering receptor expressed on myeloid cells 1 with C terminal HA tag.
Синоним гена:TREM1
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Хорек TREM-1/TREM1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Хорек TREM-1/TREM1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60048-ACGRBS15400
Хорек TREM-1/TREM1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60048-ACRRBS15400
Хорек TREM-1/TREM1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60048-CFRBS13340
Хорек TREM-1/TREM1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60048-CHRBS13340
Хорек TREM-1/TREM1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60048-CMRBS13340
Хорек TREM-1/TREM1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60048-CYRBS13340
Хорек TREM-1/TREM1 Джин клон кДНК в вектор клонированияFG60048-GRBS5130
Хорек TREM-1/TREM1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60048-NFRBS13340
Хорек TREM-1/TREM1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60048-NHRBS13340
Хорек TREM-1/TREM1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60048-NMRBS13340
Хорек TREM-1/TREM1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60048-NYRBS13340
Хорек TREM-1/TREM1 Джин ORF экспрессии кДНК клона плазмидыFG60048-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

TREM1 (triggering receptor expressed on myeloid cells) is a type I  transmembrane protein with a single Ig-like domain, and is selectively expressed on blood neutrophils and a subset of monocytes. As a member of the growing family of receptors related to NK cell receptors, TREM1 activates downstream signaling events with the help of an adapter protein called DAP12. Expression of TREM1 is up-regulated by bacterial LPS, a ligand for TLR4, as well as lipoteichoic acid. Although its natural ligand has not been identified, engagement of TREM1 with agonist mAbs triggers secretion of the proinflammatory cytokines TNF-α and IL-1β, as well as chemokines such as IL-8 and monocyte chemoattractant protein (MCP)-1. Intracellularly, TREM1 induces Ca2+ mobilization and tyrosine phosphorylation of extracellular signal-related kinase 1 (ERK1), ERK2 and phospholipase C-γ. In an animal model of LPS-induced septic shock, blockade of TREM1 signaling inhibited hyperresponsiveness and death. Thus, it has been demonstrated that TREM1 performs a critical function in immune responses involved in host defense against microbial challenges, and is suggested to be a potential therapeutic target for septic shock.

  • Bouchon, A. et al., 2000, J. Immunol. 164: 4991-4995.
  • Bouchon, A. et al., 2001, Nature. 410: 1103-1107.
  • Bleharski, J.R. et al., 2003, J. Immunol. 170: 3812-3818.
  • Size / Price
    Каталог: FG60048-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.