Быстрый заказ

Хорек TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Ferret TNF Информация о продукте «Клон cDNA»
Размер кДНК:702bp
Описание кДНК:Full length Clone DNA of Ferret TNF alpha with N terminal HA tag.
Синоним гена:TNFA
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Хорек TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Хорек TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60002-ACGRBS15400
Хорек TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60002-ACRRBS15400
Хорек TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60002-CFRBS13340
Хорек TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60002-CHRBS13340
Хорек TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60002-CMRBS13340
Хорек TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60002-CYRBS13340
Хорек TNF-alpha/TNFA/TNFSF2 Джин клон кДНК в вектор клонированияFG60002-GRBS5130
Хорек TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60002-NFRBS13340
Хорек TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60002-NHRBS13340
Хорек TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60002-NMRBS13340
Хорек TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60002-NYRBS13340
Хорек TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмидыFG60002-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Tumor necrosis factor alpha (TNF-alpha), also known as TNF, TNFA or TNFSF2, is the prototypic cytokine of the TNF superfamily, and is a multifunctional molecule involved in the regulation of a wide spectrum of biological processes including cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation. Two receptors, TNF-R1 (TNF receptor type 1; CD120a; p55/60) and TNF-R2 (TNF receptor type 2; CD120b; p75/80), bind to TNF-alpha. TNF-alpha protein is produced mainly by macrophages, and large amounts of this cytokine are released in response to lipopolysaccharide, other bacterial products, and Interleukin-1 (IL-1). TNF-alpha is involved in fighting against the tumorigenesis, thus, is regarded as a molecular insight in cancer treatment.

TNF-alpha Protein & Antibody

  • Hector J, et al. (2007) TNF-alpha alters visfatin and adiponectin levels in human fat. Horm Metab Res. 39(4): 250-5.
  • Berthold-Losleben M, et al. (2008) The TNF-alpha System: Functional Aspects in Depression, Narcolepsy and Psychopharmacology. Curr Neuropharmacol. 6(3): 193-202.
  • Size / Price
    Каталог: FG60002-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.