Thy1 / CD90 cDNA ORF Clone, Ferret, N-HA tag

Price:
Size:
Number:

Thy1 / CD90 cDNA ORF Clone, Ferret, N-HA tag: General Information

Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
486 bp
Description
Full length Clone DNA of Ferret Thy-1 cell surface antigen with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Thy1 / CD90 Background Information

Thy-1 membrane glycoprotein, also known as Thy-1 antigen, CD9 and THY1, is a cell membrane protein which contains 1 Ig-like V-type (immunoglobulin-like) domain. It is a glycophosphatidylinositol-linked glycoprotein expressed on the surface of neurons, thymocytes, subsets of fibroblasts, endothelial cells, mesangial cells and some hematopoietic cells. It has been identified on a variety of stem cells and at varying levels in non-lymphoid tissues such as on fibroblasts, brain cells, and activated endothelial cells. Thy-1 is evolutionarily conserved, developmentally regulated, and often has dramatic effects on cell phenotype. Thy-1 is a 25-37 kDa glycosylphosphatidylinositol (GPI)-anchored protein involved in T cell activation, neurite outgrowth, apoptosis, tumor suppression, wound healing, and fibrosis. To mediate these diverse effects, Thy-1 participates in multiple signaling cascades. Thy-1 is an important regulator of cell-cell and cell-matrix interactions, with important roles in nerve regeneration, metastasis, inflammation, and fibrosis.
Full Name
Thy-1 cell surface antigen
References
  • Rege TA, et al. (2006) Thy-1 as a regulator of cell-cell and cell-matrix interactions in axon regeneration, apoptosis, adhesion, migration, cancer, and fibrosis. FASEB J. 20(8): 1045-54.
  • Fiegel HC, et al. (2008) Lack of Thy1 (CD90) expression in neuroblastomas is correlated with impaired survival. Pediatr Surg Int. 24(1): 101-5.
  • Bradley JE, et al. (2009) Roles and regulation of Thy-1, a context-dependent modulator of cell phenotype. Biofactors. 35(3): 258-65.
  • Kisselbach L, et al. (2009) CD90 Expression on human primary cells and elimination of contaminating fibroblasts from cell cultures. Cytotechnology. 59(1): 31-44.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait