Быстрый заказ

Хорек CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Ferret THY1 Информация о продукте «Клон cDNA»
Размер кДНК:486bp
Описание кДНК:Full length Clone DNA of Mustela putorius furo (sub-species: furo) Thy-1 cell surface antigen with C terminal HA tag.
Синоним гена:THY1
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Хорек CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Хорек CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60039-ACGRBS15400
Хорек CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60039-ACRRBS15400
Хорек CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60039-CFRBS13340
Хорек CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60039-CHRBS13340
Хорек CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60039-CMRBS13340
Хорек CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60039-CYRBS13340
Хорек CD90/THY-1 Джин клон кДНК в вектор клонированияFG60039-GRBS5130
Хорек CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60039-NFRBS13340
Хорек CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60039-NHRBS13340
Хорек CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60039-NMRBS13340
Хорек CD90/THY-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60039-NYRBS13340
Хорек CD90/THY-1 Джин ORF экспрессии кДНК клона плазмидыFG60039-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Mouse Thy-1 membrane glycoprotein, also known as Thy-1 antigen, CD90 and THY1, is a cell membrane protein which contains 1 Ig-like V-type (immunoglobulin-like) domain. It is a glycophosphatidylinositol-linked glycoprotein expressed on the surface of neurons, thymocytes, subsets of fibroblasts, endothelial cells, mesangial cells and some hematopoietic cells. It has been identified on a variety of stem cells and at varying levels in non-lymphoid tissues such as on fibroblasts, brain cells, and activated endothelial cells. Thy-1 is evolutionarily conserved, developmentally regulated, and often has dramatic effects on cell phenotype. Thy-1 is a 25-37 kDa glycosylphosphatidylinositol (GPI)-anchored protein involved in T cell activation, neurite outgrowth, apoptosis, tumor suppression, wound healing, and fibrosis. To mediate these diverse effects, Thy-1 participates in multiple signaling cascades. Thy-1 is an important regulator of cell-cell and cell-matrix interactions, with important roles in nerve regeneration, metastasis, inflammation, and fibrosis.

  • Rege TA, et al. (2006) Thy-1 as a regulator of cell-cell and cell-matrix interactions in axon regeneration, apoptosis, adhesion, migration, cancer, and fibrosis. FASEB J. 20(8): 1045-54.
  • Fiegel HC, et al. (2008) Lack of Thy1 (CD90) expression in neuroblastomas is correlated with impaired survival. Pediatr Surg Int. 24(1): 101-5.
  • Bradley JE, et al. (2009) Roles and regulation of Thy-1, a context-dependent modulator of cell phenotype. Biofactors. 35(3): 258-65.
  • Kisselbach L, et al. (2009) CD90 Expression on human primary cells and elimination of contaminating fibroblasts from cell cultures. Cytotechnology. 59(1): 31-44.
  • Size / Price
    Каталог: FG60039-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.