After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Ferret STX8 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_004760175.1
Размер кДНК:711bp
Описание кДНК:Full length Clone DNA of Mustela putorius furo (sub-species: furo) syntaxin 8 with N terminal Flag tag.
Синоним гена:STX8
Виды:Ferret
переносчик:pCMV3-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60077-ACGRBS15400
Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60077-ACRRBS15400
Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаFG60077-ANGRBS15400
Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаFG60077-ANRRBS15400
Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60077-CFRBS13340
Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60077-CHRBS13340
Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60077-CMRBS13340
Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60077-CYRBS13340
Хорек STX8 / Syntaxin 8 Джин клон кДНК в вектор клонированияFG60077-GRBS5130
Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60077-NFRBS13340
Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60077-NHRBS13340
Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60077-NMRBS13340
Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60077-NYRBS13340
Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмидыFG60077-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

STX8, also known as syntaxin 8, directly interacts with HECTd3. STX8 forms the SNARE complex with syntaxin 7, vti1b and endobrevin. STX8 belongs to the syntaxin family. Members of this family are key molecules implicated in diverse vesicle docking and membrane fusion events. STX8 physically interacts with cystic fibrosis transmembrane conductance regulator (CFTR): recombinant syntaxin 8 binds CFTR in vitro and both proteins co-immunoprecipitate in HT29 cells. Syntaxin 8 regulates CFTR-mediated currents in chinese hamster ovary (CHO) cells stably expressing CFTR and syntaxin 8. STX8 contributes to the regulation of CFTR trafficking and chloride channel activity by the SNARE machinery.

Ссылки
  • Steegmaier M. et al., 1999, J Biol Chem. 273 (51): 34171-9.
  • Thoreau V. et al., 1999, Biochem Biophys Res Commun. 257 (2): 577-83.
  • Zhang L. et al., 2009, Cell Mol Neurobiol. 29 (1): 115-21.
  • Bilan F. et al., 2004, J Cell Sci. 117 (10): 1923-35.
  • Size / Price
    Каталог: FG60077-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».