Быстрый заказ

Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Хорек STX8 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:XM_004760175.1
    Размер кДНК:711bp
    Описание кДНК:Full length Clone DNA of Mustela putorius furo (sub-species: furo) syntaxin 8 with C terminal Myc tag.
    Синоним гена:STX8
    Виды:Ferret
    переносчик:pCMV3-C-Myc
    Plasmid:
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
    Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60077-ACGRBS15400
    Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60077-ACRRBS15400
    Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаFG60077-ANGRBS15400
    Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаFG60077-ANRRBS15400
    Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60077-CFRBS13340
    Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60077-CHRBS13340
    Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60077-CMRBS13340
    Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60077-CYRBS13340
    Хорек STX8 / Syntaxin 8 Джин клон кДНК в вектор клонированияFG60077-GRBS5130
    Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60077-NFRBS13340
    Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60077-NHRBS13340
    Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60077-NMRBS13340
    Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60077-NYRBS13340
    Хорек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмидыFG60077-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    STX8, also known as syntaxin 8, directly interacts with HECTd3. STX8 forms the SNARE complex with syntaxin 7, vti1b and endobrevin. STX8 belongs to the syntaxin family. Members of this family are key molecules implicated in diverse vesicle docking and membrane fusion events. STX8 physically interacts with cystic fibrosis transmembrane conductance regulator (CFTR): recombinant syntaxin 8 binds CFTR in vitro and both proteins co-immunoprecipitate in HT29 cells. Syntaxin 8 regulates CFTR-mediated currents in chinese hamster ovary (CHO) cells stably expressing CFTR and syntaxin 8. STX8 contributes to the regulation of CFTR trafficking and chloride channel activity by the SNARE machinery.

    Ссылки
  • Steegmaier M. et al., 1999, J Biol Chem. 273 (51): 34171-9.
  • Thoreau V. et al., 1999, Biochem Biophys Res Commun. 257 (2): 577-83.
  • Zhang L. et al., 2009, Cell Mol Neurobiol. 29 (1): 115-21.
  • Bilan F. et al., 2004, J Cell Sci. 117 (10): 1923-35.
  • Size / Price
    Каталог: FG60077-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».