After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Хорек SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Ferret SIGIRR Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_004781062.1
Размер кДНК:1233bp
Описание кДНК:Full length Clone DNA of Mustela putorius furo (sub-species: furo) single immunoglobulin and toll-interleukin 1 receptor (TIR) domain with N terminal Flag tag.
Синоним гена:SIGIRR
Виды:Ferret
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Хорек SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Хорек SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60096-ACGRBS15400
Хорек SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60096-ACRRBS15400
Хорек SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60096-CFRBS13340
Хорек SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60096-CHRBS13340
Хорек SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60096-CMRBS13340
Хорек SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60096-CYRBS13340
Хорек SIGIRR/TIR8 Джин клон кДНК в вектор клонированияFG60096-GRBS5130
Хорек SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60096-NFRBS13340
Хорек SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60096-NHRBS13340
Хорек SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60096-NMRBS13340
Хорек SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60096-NYRBS13340
Хорек SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмидыFG60096-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Single Ig IL-1-related receptor (SIGIRR) or TIR8 is a member of Toll-like receptor-interleukin 1 receptor signaling (TLR-IL-1R) receptor superfamily. Although SIGIRR/TIR8 shows the typical conserved motifs that characterize the IL-1R and Toll superfamily, it is structurally and functionally distinct from both. SIGIRR/TIR8 has only one Ig domain in its extracellular portion whereas the IL-1R family contains three Ig folds. An unusually long cytoplasmic domain is reminiscent of the structure of drosophila Toll, yet the SIGIRR peptide sequence is more closely related to IL-1RI. SIGIRR/TIR8 was mainly expressed in mouse and human epithelial tissues such as kidney, lung and gut. Resting and activated T and B lymphocytes and monocytes-macrophages expressed little or no SIGIRR/TIR8, with the exception of the mouse GG2EE macrophage line. Inflammation is enhanced in SIGIRR-deficient mice. SIGIRR negatively modulates immune responses. Inflammation is enhanced in SIGIRR-deficient mice, as shown by their enhanced chemokine induction after IL-1 injection and reduced threshold for lethal endotoxin challenge.

Ссылки
  • Wald D, et al. (2003) SIGIRR, a negative regulator of Toll-like receptor-interleukin 1 receptor signaling. Nat Immunol. 4(9): 920-7.
  • Polentarutti N, et al. (2003) Unique pattern of expression and inhibition of IL-1 signaling by the IL-1 receptor family member TIR8/SIGIRR. Eur Cytokine Netw. 14(4): 211-8.
  • Wald D, et al. (2003) SIGIRR, a negative regulator of Toll-like receptor-interleukin 1 receptor signaling. Nat Immunol. 4(9): 920-7.
  • Size / Price
    Каталог: FG60096-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».