After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Хорек C1 inhibitor/SerpinG1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Ferret SERPING1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_004777588.1
Размер кДНК:1440bp
Описание кДНК:Full length Clone DNA of Mustela putorius furo (sub-species: furo) serpin peptidase inhibitor, clade G (C1 inhibitor), member 1 with N terminal Flag tag.
Синоним гена:SERPING1
Виды:Ferret
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Хорек C1 inhibitor/SerpinG1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Хорек C1 inhibitor/SerpinG1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60083-ACGRBS15396
Хорек C1 inhibitor/SerpinG1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60083-ACRRBS15396
Хорек C1 inhibitor/SerpinG1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60083-CFRBS13343
Хорек C1 inhibitor/SerpinG1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60083-CHRBS13343
Хорек C1 inhibitor/SerpinG1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60083-CMRBS13343
Хорек C1 inhibitor/SerpinG1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60083-CYRBS13343
Хорек C1 inhibitor/SerpinG1 Джин клон кДНК в вектор клонированияFG60083-GRBS5132
Хорек C1 inhibitor/SerpinG1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60083-NFRBS13343
Хорек C1 inhibitor/SerpinG1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60083-NHRBS13343
Хорек C1 inhibitor/SerpinG1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60083-NMRBS13343
Хорек C1 inhibitor/SerpinG1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60083-NYRBS13343
Хорек C1 inhibitor/SerpinG1 Джин ORF экспрессии кДНК клона плазмидыFG60083-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Plasma protease C1 inhibitor, also known as C1-inhibiting factor, C1-INH, C1 esterase inhibitor, SERPING1 and C1IN, is a serine proteinase inhibitor (serpin) that regulates activation of both the complement and contact systems. By its C-terminal part (serpin domain), characterized by three beta-sheets and an exposed mobile reactive loop, C1-INH binds, and blocks the activity of its target proteases. The N-terminal end (nonserpin domain) confers to C1-INH the capacity to bind lipopolysaccharides and E-selectin. Owing to this moiety, C1-INH intervenes in regulation of the inflammatory reaction. The heterozygous deficiency of C1-INH results in hereditary angioedema (HAE). Owing to its ability to modulate the contact and complement systems and the convincing safety profile, plasma-derived C1 inhibitor is an attractive therapeutic protein to treat inflammatory diseases other than HAE. Deficiency of C1 inhibitor results in hereditary angioedema, which is characterized by recurrent episodes of localized angioedema of the skin, gastrointestinal mucosa or upper respiratory mucosa. C1 inhibitor may prove useful in a variety of other diseases including septic shock, reperfusion injury, hyperacute transplant rejection, traumatic and hemorrhagic shock, and the increased vascular permeability associated with thermal injury, interleukin-2 therapy and cardiopulmonary bypass.

Ссылки
  • Davis AE 3rd. et al. (2004) Biological effects of C1 inhibitor. Drug News Perspect. 17(7): 439-46.
  • Cicardi M, et al. (2005) C1 inhibitor: molecular and clinical aspects. Springer Semin Immunopathol. 27(3): 286-98.
  • Wouters D, et al. (2008) C1 inhibitor: just a serine protease inhibitor? New and old considerations on therapeutic applications of C1 inhibitor. Expert Opin Biol Ther. 8(8): 1225-40.
  • Cugno M, et al. (2009) C1-inhibitor deficiency and angioedema: molecular mechanisms and clinical progress. Trends Mol Med. 15(2): 69-78.
  • Size / Price
    Каталог: FG60083-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».