Быстрый заказ

Text Size:AAA

Хорек RPL10 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Ferret RPL10 Информация о продукте «Клон cDNA»
Размер кДНК:645bp
Описание кДНК:Full length Clone DNA of Mustela putorius furo (sub-species: furo) ribosomal protein L10 with N terminal HA tag.
Синоним гена:RPL10
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Хорек RPL10 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Хорек RPL10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60057-ACGRBS15400
Хорек RPL10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60057-ACRRBS15400
Хорек RPL10 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаFG60057-ANGRBS15400
Хорек RPL10 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаFG60057-ANRRBS15400
Хорек RPL10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60057-CFRBS13340
Хорек RPL10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60057-CHRBS13340
Хорек RPL10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60057-CMRBS13340
Хорек RPL10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60057-CYRBS13340
Хорек RPL10 Джин клон кДНК в вектор клонированияFG60057-GRBS5130
Хорек RPL10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60057-NFRBS13340
Хорек RPL10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60057-NHRBS13340
Хорек RPL10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60057-NMRBS13340
Хорек RPL10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60057-NYRBS13340
Хорек RPL10 Джин ORF экспрессии кДНК клона плазмидыFG60057-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: FG60057-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.