After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Хорек RAP1B Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Ferret RAP1B Информация о продукте «Клон cDNA»
Размер кДНК:555bp
Описание кДНК:Full length Clone DNA of Mustela putorius furo (sub-species: furo) RAP1B, member of RAS oncogene family with C terminal HA tag.
Синоним гена:RAP1B
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Хорек RAP1B Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Хорек RAP1B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60045-ACGRBS15400
Хорек RAP1B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60045-ACRRBS15400
Хорек RAP1B Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаFG60045-ANGRBS15400
Хорек RAP1B Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаFG60045-ANRRBS15400
Хорек RAP1B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60045-CFRBS13340
Хорек RAP1B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60045-CHRBS13340
Хорек RAP1B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60045-CMRBS13340
Хорек RAP1B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60045-CYRBS13340
Хорек RAP1B Джин клон кДНК в вектор клонированияFG60045-GRBS5130
Хорек RAP1B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60045-NFRBS13340
Хорек RAP1B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60045-NHRBS13340
Хорек RAP1B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60045-NMRBS13340
Хорек RAP1B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60045-NYRBS13340
Хорек RAP1B Джин ORF экспрессии кДНК клона плазмидыFG60045-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: FG60045-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.