PRG2 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag

Cat: FG60073-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PRG2 Reagents
CRO Services
Product recommended

All PRG2 Reagents
PRG2 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
681 bp
Description
Full length Clone DNA of Ferret proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRG2 Background Information
Full Name
proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein)

PRG2 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
PRG2 cDNA ORF Clone in Cloning Vector, Ferret FG60073-G
PRG2 cDNA ORF Clone, Ferret, untagged FG60073-UT
PRG2 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60073-ACG
PRG2 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60073-ACGLN
PRG2 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60073-ANG
PRG2 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60073-ACR
PRG2 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60073-ANR
PRG2 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60073-CF
PRG2 cDNA ORF Clone, Ferret, C-His tag FG60073-CH
PRG2 cDNA ORF Clone, Ferret, N-His tag FG60073-NH
PRG2 cDNA ORF Clone, Ferret, C-HA tag FG60073-CY
PRG2 cDNA ORF Clone, Ferret, N-HA tag FG60073-NY
PRG2 cDNA ORF Clone, Ferret, C-Myc tag FG60073-CM
PRG2 cDNA ORF Clone, Ferret, N-Myc tag FG60073-NM

PRG2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PRG2 cDNA ORF Clone in Cloning Vector, Mouse MG53807-U
PRG2 cDNA ORF Clone, Mouse, untagged MG53807-UT
PRG2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53807-ACG
PRG2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53807-ACGLN
PRG2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53807-ACR
PRG2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53807-CF
PRG2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53807-NF
PRG2 cDNA ORF Clone, Mouse, C-His tag MG53807-CH
PRG2 cDNA ORF Clone, Mouse, N-His tag MG53807-NH
PRG2 cDNA ORF Clone, Mouse, C-HA tag MG53807-CY
PRG2 cDNA ORF Clone, Mouse, N-HA tag MG53807-NY
PRG2 cDNA ORF Clone, Mouse, C-Myc tag MG53807-CM
PRG2 cDNA ORF Clone, Mouse, N-Myc tag MG53807-NM

PRG2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PRG2 cDNA ORF Clone in Cloning Vector, Human HG16787-U
PRG2 cDNA ORF Clone, Human, untagged HG16787-UT
PRG2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16787-ACGLN
PRG2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16787-ACG
PRG2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16787-ACR
PRG2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16787-CF
PRG2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16787-NF
PRG2 cDNA ORF Clone, Human, C-His tag HG16787-CH
PRG2 cDNA ORF Clone, Human, N-His tag HG16787-NH
PRG2 cDNA ORF Clone, Human, C-HA tag HG16787-CY
PRG2 cDNA ORF Clone, Human, N-HA tag HG16787-NY
PRG2 cDNA ORF Clone, Human, C-Myc tag HG16787-CM
PRG2 cDNA ORF Clone, Human, N-Myc tag HG16787-NM
info info
添加购物车成功! 添加购物车失败!