Быстрый заказ

Text Size:AAA

Хорек NHP2L1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Ferret NHP2L1 Информация о продукте «Клон cDNA»
Размер кДНК:387bp
Описание кДНК:Full length Clone DNA of Mustela putorius furo (sub-species: furo) NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) with C terminal Myc tag.
Синоним гена:NHP2L1
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Хорек NHP2L1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Хорек NHP2L1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60087-ACGRBS15400
Хорек NHP2L1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60087-ACRRBS15400
Хорек NHP2L1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаFG60087-ANGRBS15400
Хорек NHP2L1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаFG60087-ANRRBS15400
Хорек NHP2L1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60087-CFRBS13340
Хорек NHP2L1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60087-CHRBS13340
Хорек NHP2L1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60087-CMRBS13340
Хорек NHP2L1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60087-CYRBS13340
Хорек NHP2L1 Джин клон кДНК в вектор клонированияFG60087-GRBS5130
Хорек NHP2L1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60087-NFRBS13340
Хорек NHP2L1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60087-NHRBS13340
Хорек NHP2L1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60087-NMRBS13340
Хорек NHP2L1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60087-NYRBS13340
Хорек NHP2L1 Джин ORF экспрессии кДНК клона плазмидыFG60087-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.