Быстрый заказ

Хорек MRPL39 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Ferret MRPL39 Информация о продукте «Клон cDNA»
Размер кДНК:1008bp
Описание кДНК:Full length Clone DNA of Mustela putorius furo mitochondrial ribosomal protein L39 with C terminal His tag.
Синоним гена:MRPL39
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Хорек MRPL39 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Хорек MRPL39 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60159-ACGRBS15400
Хорек MRPL39 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60159-ACRRBS15400
Хорек MRPL39 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаFG60159-ANGRBS15400
Хорек MRPL39 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаFG60159-ANRRBS15400
Хорек MRPL39 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60159-CFRBS13340
Хорек MRPL39 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60159-CHRBS13340
Хорек MRPL39 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60159-CMRBS13340
Хорек MRPL39 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60159-CYRBS13340
Хорек MRPL39 Джин клон кДНК в вектор клонированияFG60159-GRBS5130
Хорек MRPL39 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60159-NFRBS13340
Хорек MRPL39 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60159-NHRBS13340
Хорек MRPL39 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60159-NMRBS13340
Хорек MRPL39 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60159-NYRBS13340
Хорек MRPL39 Джин ORF экспрессии кДНК клона плазмидыFG60159-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: FG60159-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.