After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Хорек METTL7A Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Ferret METTL7A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_004782069.1
Размер кДНК:735bp
Описание кДНК:Full length Clone DNA of Mustela putorius furo (sub-species: furo) methyltransferase like 7A with N terminal HA tag.
Синоним гена:METTL7A
Виды:Ferret
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Хорек METTL7A Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Хорек METTL7A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60050-ACGRBS15400
Хорек METTL7A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60050-ACRRBS15400
Хорек METTL7A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60050-CFRBS13340
Хорек METTL7A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60050-CHRBS13340
Хорек METTL7A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60050-CMRBS13340
Хорек METTL7A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60050-CYRBS13340
Хорек METTL7A Джин клон кДНК в вектор клонированияFG60050-GRBS5130
Хорек METTL7A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60050-NFRBS13340
Хорек METTL7A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60050-NHRBS13340
Хорек METTL7A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60050-NMRBS13340
Хорек METTL7A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60050-NYRBS13340
Хорек METTL7A Джин ORF экспрессии кДНК клона плазмидыFG60050-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: FG60050-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».