After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Хорек METTL3/Methyltransferase like 3 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Ferret METTL3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_004758578.1
Размер кДНК:1743bp
Описание кДНК:Full length Clone DNA of Mustela putorius furo (sub-species: furo) methyltransferase like 3 with C terminal HA tag.
Синоним гена:METTL3
Виды:Ferret
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Хорек METTL3/Methyltransferase like 3 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Хорек METTL3/Methyltransferase like 3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60040-ACGRBS16760
Хорек METTL3/Methyltransferase like 3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60040-ACRRBS16760
Хорек METTL3/Methyltransferase like 3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаFG60040-ANGRBS16760
Хорек METTL3/Methyltransferase like 3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаFG60040-ANRRBS16760
Хорек METTL3/Methyltransferase like 3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60040-CFRBS14710
Хорек METTL3/Methyltransferase like 3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60040-CHRBS14710
Хорек METTL3/Methyltransferase like 3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60040-CMRBS14710
Хорек METTL3/Methyltransferase like 3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60040-CYRBS14710
Хорек METTL3/Methyltransferase like 3 Джин клон кДНК в вектор клонированияFG60040-GRBS5130
Хорек METTL3/Methyltransferase like 3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60040-NFRBS14710
Хорек METTL3/Methyltransferase like 3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60040-NHRBS14710
Хорек METTL3/Methyltransferase like 3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60040-NMRBS14710
Хорек METTL3/Methyltransferase like 3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60040-NYRBS14710
Хорек METTL3/Methyltransferase like 3 Джин ORF экспрессии кДНК клона плазмидыFG60040-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: FG60040-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».