Быстрый заказ

Хорек RPS9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Хорек LOC101673489 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_004825488.1
Размер кДНК:585bp
Описание кДНК:Full length Clone DNA of Mustela putorius furo (sub-species: furo) 40S ribosomal protein S9-like with N terminal Flag tag.
Синоним гена:LOC101673489
Виды:Ferret
переносчик:pCMV3-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Хорек RPS9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Хорек RPS9 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60081-ACGRBS22240
Хорек RPS9 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60081-ACRRBS22240
Хорек RPS9 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаFG60081-ANGRBS22240
Хорек RPS9 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаFG60081-ANRRBS22240
Хорек RPS9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60081-CFRBS20190
Хорек RPS9 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60081-CHRBS20190
Хорек RPS9 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60081-CMRBS20190
Хорек RPS9 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60081-CYRBS20190
Хорек RPS9 Джин клон кДНК в вектор клонированияFG60081-GRBS5130
Хорек RPS9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60081-NFRBS20190
Хорек RPS9 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60081-NHRBS20190
Хорек RPS9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60081-NMRBS20190
Хорек RPS9 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60081-NYRBS20190
Хорек RPS9 Джин ORF экспрессии кДНК клона плазмидыFG60081-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: FG60081-NF
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».