After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Хорек CD177 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Ferret LOC101671889 Информация о продукте «Клон cDNA»
Размер кДНК:1329bp
Описание кДНК:Full length Clone DNA of Mustela putorius furo (sub-species: furo) CD177 antigen-like with C terminal Myc tag.
Синоним гена:LOC101671889
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Хорек CD177 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Хорек CD177 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60079-ACGRBS15400
Хорек CD177 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60079-ACRRBS15400
Хорек CD177 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60079-CFRBS13340
Хорек CD177 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60079-CHRBS13340
Хорек CD177 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60079-CMRBS13340
Хорек CD177 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60079-CYRBS13340
Хорек CD177 Джин клон кДНК в вектор клонированияFG60079-GRBS5130
Хорек CD177 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60079-NFRBS13340
Хорек CD177 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60079-NHRBS13340
Хорек CD177 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60079-NMRBS13340
Хорек CD177 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60079-NYRBS13340
Хорек CD177 Джин ORF экспрессии кДНК клона плазмидыFG60079-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: FG60079-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.