Быстрый заказ

Text Size:AAA

Хорек Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Ferret IFNG Информация о продукте «Клон cDNA»
Размер кДНК:501bp
Описание кДНК:Full length Clone DNA of Ferret Interferon gamma with N terminal HA tag.
Синоним гена:IFNG
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Хорек Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Хорек Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60007-ACGRBS15396
Хорек Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60007-ACRRBS15396
Хорек Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60007-CFRBS13343
Хорек Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60007-CHRBS13343
Хорек Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60007-CMRBS13343
Хорек Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60007-CYRBS13343
Хорек Interferon Gamma/IFN gamma/IFNG Джин клон кДНК в вектор клонированияFG60007-GRBS5132
Хорек Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60007-G-HRBS13343
Хорек Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60007-NFRBS13343
Хорек Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60007-NHRBS13343
Хорек Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60007-NMRBS13343
Хорек Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60007-NYRBS13343
Хорек Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмидыFG60007-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name

IFN gamma, also known as IFNG, is a secreted protein which belongs to the type I I interferon family. IFN gamma is produced predominantly by natural killer and natural killer T cells as part of the innate immune response, and by CD4 and CD8 cytotoxic T lymphocyte effector T cells once antigen-specific immunity develops. IFN gamma has antiviral, immunoregulatory, and anti-tumor properties. IFNG, in addition to having antiviral activity, has important immunoregulatory functions, it is a potent activator of macrophages, and has antiproliferative effects on transformed cells and it can potentiate the antiviral and antitumor effects of the type I interferons. The IFNG monomer consists of a core of six α-helices and an extended unfolded sequence in the C-terminal region. IFN gamma is critical for innate and adaptive immunity against viral and intracellular bacterial infections and for tumor control. Aberrant IFN gamma expression is associated with a number of autoinflammatory and autoimmune diseases. The importance of IFN gamma in the immune system stems in part from its ability to inhibit viral replication directly, and most importantly from its immunostimulatory and immunomodulatory effects. IFNG also promotes NK cell activity.

  • Gray P W, et al. (1982) Structure of the human immune interferon gene. Nature. 298: 859-63.
  • Taya Y, et al. (1982) Cloning and structure of the human immune interferon-gamma chromosomal gene. EMBO J. 1: 953-8.
  • Goshima N, et al. (2008) Human protein factory for converting the transcriptome into an in vitro-expressed proteome. Nomura N Nat Methods. 5: 1011-7.
  • Thiel DJ, et al. (2000) Observation of an unexpected third receptor molecule in the crystal structure of human interferon-gamma receptor complex. Structure. 8 (9): 927-36.
  • Naylor SL, et al. (1983) Human immune interferon gene is located on chromosome 12. J Exp Med. 157 (3): 1020-7.
  • Schoenborn JR, et al. (2007) Regulation of interferon-gamma during innate and adaptive immune responses. Adv Immunol. 96: 41-101.
  • Size / Price
    Каталог: FG60007-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.