Glutamine Synthetase / GLUL cDNA ORF Clone, Ferret, C-Myc tag

Price:
Size:
Number:

Glutamine Synthetase / GLUL cDNA ORF Clone, Ferret, C-Myc tag: General Information

Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1245 bp
Description
Full length Clone DNA of Ferret glutamate-ammonia ligase with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Glutamine Synthetase / GLUL Background Information

Glutamate-ammonia ligase (GLUL) belongs to the glutamine synthetase family. GLUL was heterogeneously expressed in various breast cancer cells. GLUL may represent a novel target for selectively inhibiting p38 MAPK and ERK1/ERK2 signaling pathways and the proliferation potential of breast cancer cells.
Full Name
glutamate-ammonia ligase
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait