Быстрый заказ

Хорек FAM188A Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Хорек FAM188A Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:XM_004757565.1
    Размер кДНК:1338bp
    Описание кДНК:Full length Clone DNA of Mustela putorius furo (sub-species: furo) family with sequence similarity 188, member A with N terminal HA tag.
    Синоним гена:FAM188A
    Виды:Ferret
    переносчик:pCMV3-N-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Хорек FAM188A Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
    Хорек FAM188A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60046-ACGRBS15400
    Хорек FAM188A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60046-ACRRBS15400
    Хорек FAM188A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаFG60046-ANGRBS15400
    Хорек FAM188A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаFG60046-ANRRBS15400
    Хорек FAM188A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60046-CFRBS13340
    Хорек FAM188A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60046-CHRBS13340
    Хорек FAM188A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60046-CMRBS13340
    Хорек FAM188A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60046-CYRBS13340
    Хорек FAM188A Джин клон кДНК в вектор клонированияFG60046-GRBS5130
    Хорек FAM188A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60046-NFRBS13340
    Хорек FAM188A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60046-NHRBS13340
    Хорек FAM188A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60046-NMRBS13340
    Хорек FAM188A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60046-NYRBS13340
    Хорек FAM188A Джин ORF экспрессии кДНК клона плазмидыFG60046-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».