Быстрый заказ

Хорек ETFB Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Хорек ETFB Информация о продукте «Клон cDNA»
    Размер кДНК:768bp
    Описание кДНК:Full length Clone DNA of Mustela putorius furo (sub-species: furo) electron-transfer-flavoprotein, beta polypeptide with C terminal Myc tag.
    Синоним гена:ETFB
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Хорек ETFB Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
    Хорек ETFB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60075-ACGRBS15400
    Хорек ETFB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60075-ACRRBS15400
    Хорек ETFB Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаFG60075-ANGRBS15400
    Хорек ETFB Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаFG60075-ANRRBS15400
    Хорек ETFB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60075-CFRBS13340
    Хорек ETFB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60075-CHRBS13340
    Хорек ETFB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60075-CMRBS13340
    Хорек ETFB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60075-CYRBS13340
    Хорек ETFB Джин клон кДНК в вектор клонированияFG60075-GRBS5130
    Хорек ETFB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60075-NFRBS13340
    Хорек ETFB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60075-NHRBS13340
    Хорек ETFB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60075-NMRBS13340
    Хорек ETFB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60075-NYRBS13340
    Хорек ETFB Джин ORF экспрессии кДНК клона плазмидыFG60075-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: FG60075-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.