Быстрый заказ

Text Size:AAA

Хорек ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Ferret ENO1 Информация о продукте «Клон cDNA»
Размер кДНК:1305bp
Описание кДНК:Full length Clone DNA of Mustela putorius furo (sub-species: furo) enolase 1, (alpha) with N terminal Flag tag.
Синоним гена:ENO1
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Хорек ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Хорек ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60094-ACGRBS15400
Хорек ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60094-ACRRBS15400
Хорек ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаFG60094-ANGRBS15400
Хорек ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаFG60094-ANRRBS15400
Хорек ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60094-CFRBS13340
Хорек ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60094-CHRBS13340
Хорек ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60094-CMRBS13340
Хорек ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60094-CYRBS13340
Хорек ENO1 / Enolase 1 / alpha-enolase Джин клон кДНК в вектор клонированияFG60094-GRBS5130
Хорек ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60094-NFRBS13340
Хорек ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60094-NHRBS13340
Хорек ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60094-NMRBS13340
Хорек ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60094-NYRBS13340
Хорек ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмидыFG60094-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
  • Capello M, et al. (2011) a-Enolase: a promising therapeutic and diagnostic tumor target. FEBS J. 278(7): 1064-74.
  • Kang HJ, et al. (2008) Structure of human alpha-enolase (hENO1), a multifunctional glycolytic enzyme. Acta Crystallogr D Biol Crystallogr. 64(Pt 6): 651-7.
  • Lopez-Alemany R, et al. (2005) Alpha-enolase plasminogen receptor in myogenesis. Front Biosci. 10: 30-6.
  • Ejeskdr K, et al. (2005) Introduction of in vitro transcribed ENO1 mRNA into neuroblastoma cells induces cell death. BMC Cancer. 5: 161.
  • Size / Price
    Каталог: FG60094-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.