Быстрый заказ

Хорек EAPP Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Ferret EAPP Информация о продукте «Клон cDNA»
Размер кДНК:882bp
Описание кДНК:Full length Clone DNA of Mustela putorius furo (sub-species: furo) E2F-associated phosphoprotein with N terminal Flag tag.
Синоним гена:EAPP
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Хорек EAPP Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Хорек EAPP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60082-ACGRBS15396
Хорек EAPP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60082-ACRRBS15396
Хорек EAPP Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаFG60082-ANGRBS15396
Хорек EAPP Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаFG60082-ANRRBS15396
Хорек EAPP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60082-CFRBS13343
Хорек EAPP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60082-CHRBS13343
Хорек EAPP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60082-CMRBS13343
Хорек EAPP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60082-CYRBS13343
Хорек EAPP Джин клон кДНК в вектор клонированияFG60082-GRBS5132
Хорек EAPP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60082-NFRBS13343
Хорек EAPP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60082-NHRBS13343
Хорек EAPP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60082-NMRBS13343
Хорек EAPP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60082-NYRBS13343
Хорек EAPP Джин ORF экспрессии кДНК клона плазмидыFG60082-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: FG60082-NF
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.