Быстрый заказ

Text Size:AAA

Хорек dUTPase Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Ferret DUT Информация о продукте «Клон cDNA»
Размер кДНК:426bp
Описание кДНК:Full length Clone DNA of Mustela putorius furo (sub-species: furo) deoxyuridine triphosphatase with C terminal HA tag.
Синоним гена:DUT
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Хорек dUTPase Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Хорек dUTPase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60042-ACGRBS15400
Хорек dUTPase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60042-ACRRBS15400
Хорек dUTPase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаFG60042-ANGRBS15400
Хорек dUTPase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаFG60042-ANRRBS15400
Хорек dUTPase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60042-CFRBS13340
Хорек dUTPase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60042-CHRBS13340
Хорек dUTPase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60042-CMRBS13340
Хорек dUTPase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60042-CYRBS13340
Хорек dUTPase Джин клон кДНК в вектор клонированияFG60042-GRBS5130
Хорек dUTPase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60042-NFRBS13340
Хорек dUTPase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60042-NHRBS13340
Хорек dUTPase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60042-NMRBS13340
Хорек dUTPase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60042-NYRBS13340
Хорек dUTPase Джин ORF экспрессии кДНК клона плазмидыFG60042-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: FG60042-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.