After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Хорек CD8/CD8 alpha/Leu-2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Ferret CD8A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:EF492056.1
Размер кДНК:739bp
Описание кДНК:Full length Clone DNA of Ferret CD8 antigen with N terminal HA tag.
Синоним гена:CD8
Виды:Ferret
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Хорек CD8/CD8 alpha/Leu-2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Хорек CD8/CD8 alpha/Leu-2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60001-ACGRBS15400
Хорек CD8/CD8 alpha/Leu-2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60001-ACRRBS15400
Хорек CD8/CD8 alpha/Leu-2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60001-CFRBS13340
Хорек CD8/CD8 alpha/Leu-2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60001-CHRBS13340
Хорек CD8/CD8 alpha/Leu-2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60001-CMRBS13340
Хорек CD8/CD8 alpha/Leu-2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60001-CYRBS13340
Хорек CD8/CD8 alpha/Leu-2 Джин клон кДНК в вектор клонированияFG60001-GRBS5130
Хорек CD8/CD8 alpha/Leu-2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60001-NFRBS13340
Хорек CD8/CD8 alpha/Leu-2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60001-NHRBS13340
Хорек CD8/CD8 alpha/Leu-2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60001-NMRBS13340
Хорек CD8/CD8 alpha/Leu-2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60001-NYRBS13340
Хорек CD8/CD8 alpha/Leu-2 Джин ORF экспрессии кДНК клона плазмидыFG60001-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Human T-cell surface glycoprotein CD8 alpha chain, also known as CD8a, is a single-pass type I  membrane protein. The CD8 glycoprotein is expressed by thymocytes, mature T cells and natural killer (NK) cells and has been implicated in the recognition of monomorphic determinants on major histocompatibility complex (MHC) Class I antigens, and in signal transduction during the course of T-cell activation. Both human and rodent CD8 antigens are comprised of two distinct polypeptide chains, alpha and beta. The Ig domains of CD8 alpha are involved in controlling the ability of CD8 to be expressed. Mutation of B- and F-strand cysteine residues in CD8 alpha reduced the ability of the protein to fold properly and, therefore, to be expressed. Defects in CD8A are a cause of familial CD8 deficiency. Familial CD8 deficiency is a novel autosomal recessive immunologic defect characterized by absence of CD8+ cells, leading to recurrent bacterial infections.

Ссылки
References Devine, L. et al., 2000, J Immunol. 164 (2): 833-8. Arcaro, A. et al., 2000, J Immunol. 165 (4): 2068-76. Saha, K. et al., 2001, Nat Med. 7 (1): 65-72. Romero, P. et al., 2005, Eur J Immunol. 35 (11): 3092-4.
Size / Price
Каталог: FG60001-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».