After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Хорек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Ferret CD3E Информация о продукте «Клон cDNA»
Gene_bank_ref_id:EF492054.1
Размер кДНК:561bp
Описание кДНК:Full length Clone DNA of Ferret CD3 epsilon antigen with C terminal HA tag.
Синоним гена:CD3
Виды:Ferret
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Хорек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Хорек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60005-ACGRBS15400
Хорек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60005-ACRRBS15400
Хорек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60005-CFRBS13340
Хорек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60005-CHRBS13340
Хорек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60005-CMRBS13340
Хорек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60005-CYRBS13340
Хорек CD3e/CD3 epsilon Джин клон кДНК в вектор клонированияFG60005-GRBS5130
Хорек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60005-G-HRBS13340
Хорек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60005-NFRBS13340
Хорек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60005-NHRBS13340
Хорек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60005-NMRBS13340
Хорек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60005-NYRBS13340
Хорек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмидыFG60005-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

T-cell surface glycoprotein CD3 epsilon chain, also known as CD3E, is a single-pass type I membrane protein. CD3E contains 1 Ig-like (immunoglobulin-like) domain and 1 ITAM domain. CD3E, together with CD3-gamma, CD3-delta and CD3-zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T cell receptor-CD3 complex. The CD3 epsilon subunit of the T cell receptor (TCR) complex contains two defined signaling domains, a proline-rich sequence and an immune tyrosine activation motifs (ITAMs), and this complex undergoes a conformational change upon ligand binding that is thought to be important for the activation of T cells. In the CD3 epsilon mutant mice, all stages of T cell development and activation that are TCR-dependent were impaired, but not eliminated, including activation of mature naïve T cells with the MHCII presented superantigen, staphylococcal enterotoxin B, or with a strong TCR cross-linking antibody specific for either TCR-Cbeta or CD3 epsilon. T cell receptor-CD3 complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. This complex is critical for T-cell development and function, and represents one of the most complex transmembrane receptors. CD3E plays an essential role in T-cell development, and defects in CD3E gene cause severe immunodeficiency. Homozygous mutations in CD3D and CD3E genes lead to a complete block in T-cell development and thus to an early-onset severe combined immunodeficiency phenotype.

Ссылки
  • Fischer A, et al. (2005) CD3 deficiencies. Curr Opin Allergy Clin Immunol. 5(6): 491-5.
  • Wang Y, et al. (2009) A conserved CXXC motif in CD3epsilon is critical for T cell development and TCR signaling. PLoS Biol. 7(12): e1000253.
  • Martnez-Martn N, et al. (2009) Cooperativity between T cell receptor complexes revealed by conformational mutants of CD3epsilon. Sci Signal. 2(83): ra43.
  • Deford-Watts LM, et al. (2009) The cytoplasmic tail of the T cell receptor CD3 epsilon subunit contains a phospholipid-binding motif that regulates T cell functions. J Immunol. 183(2): 1055-64.
  • Size / Price
    Каталог: FG60005-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».