After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Хорек CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Ferret MS4A1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:
Размер кДНК:894bp
Описание кДНК:Full length Clone DNA of Ferret membrane-spanning 4-domains, subfamily A, member 1 with N terminal HA tag.
Синоним гена:MS4A1
Виды:Ferret
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Хорек CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Хорек CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60004-ACGRBS15400
Хорек CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60004-ACRRBS15400
Хорек CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60004-CFRBS13340
Хорек CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60004-CHRBS13340
Хорек CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60004-CMRBS13340
Хорек CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60004-CYRBS13340
Хорек CD20/MS4A1 Джин клон кДНК в вектор клонированияFG60004-GRBS5130
Хорек CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60004-NFRBS13340
Хорек CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60004-NHRBS13340
Хорек CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60004-NMRBS13340
Хорек CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60004-NYRBS13340
Хорек CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмидыFG60004-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CD20 (membrane-spanning 4-domains, subfamily A, member 1), also known as MS4A1, is a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. CD20 / MS4A1 is expressed on all stages of B cell development except the first and last. CD20 / MS4A1 is present from pre-pre B cells through memory cells, but not on either pro-B cells or plasma cells. It is a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. CD20 / MS4A1may be involved in the regulation of B-cell activation and proliferation. Defects in CD20 / MS4A1 are the cause of immunodeficiency common variable type 5(CVID5). CVID5 is a primary immunodeficiency characterized by antibody deficiency, hypogammaglobulinemia, recurrent bacterial infections and an inability to mount an antibody response to antigen. The defect results from a failure of B-cell differentiation and impaired secretion of immunoglobulins; the numbers of circulating B-cells is usually in the normal range, but can be low.

Ссылки
  • Tedder TF, et al. (1988) Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes. Proc Natl Acad Sci. 85(1): 208-12.
  • Cragg MS, et al. (2005) The biology of CD20 and its potential as a target for mAb therapy. Curr Dir Autoimmun. 8: 140-74..
  • Polyak MJ, et al. (2003) A cholesterol-dependent CD20 epitope detected by the FMC7 antibody. Leukemia. 17(7): 1384-9.
  • Size / Price
    Каталог: FG60004-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».