After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Хорек CD14 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Ferret CD14 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_004802907.1
Размер кДНК:1116bp
Описание кДНК:Full length Clone DNA of Mustela putorius furo (sub-species: furo) CD14 molecule with N terminal HA tag.
Синоним гена:CD14
Виды:Ferret
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Хорек CD14 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Хорек CD14 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60047-ACGRBS15396
Хорек CD14 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60047-ACRRBS15396
Хорек CD14 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60047-CFRBS13343
Хорек CD14 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60047-CHRBS13343
Хорек CD14 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60047-CMRBS13343
Хорек CD14 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60047-CYRBS13343
Хорек CD14 Джин клон кДНК в вектор клонированияFG60047-GRBS5132
Хорек CD14 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60047-NFRBS13343
Хорек CD14 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60047-NHRBS13343
Хорек CD14 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60047-NMRBS13343
Хорек CD14 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60047-NYRBS20185
Хорек CD14 Джин ORF экспрессии кДНК клона плазмидыFG60047-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 14 (CD14) is a member of the CD system. It takes its name from its inclusion in the CD molecule surface marker proteins. CD14 exists in two forms: a form anchored into the membrane or a soluble form. CD14 was found expressed in macrophages, neutrophil granulocyte and dendritic cells. The major function is serve as a co-receptor (along with TLR4 and MD-2) for the bacterial lipopolysaccharide (LPS) and other pathogen-associated molecular patterns.

Ссылки
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • SD Wright, et al. (1990) CD14, a receptor for complexes of lipopolysaccharide (LPS) and LPS binding protein. Science. 249 (4975): 1431-3.
  • Size / Price
    Каталог: FG60047-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».