Быстрый заказ

Хорек CCT8/TCP1 theta Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Ferret CCT8 Информация о продукте «Клон cDNA»
Размер кДНК:1647bp
Описание кДНК:Full length Clone DNA of Mustela putorius furo (sub-species: furo) chaperonin containing TCP1, subunit 8 (theta) with N terminal Flag tag.
Синоним гена:CCT8
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Хорек CCT8/TCP1 theta Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Хорек CCT8/TCP1 theta Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60078-ACGRBS16764
Хорек CCT8/TCP1 theta Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60078-ACRRBS16764
Хорек CCT8/TCP1 theta Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаFG60078-ANGRBS16764
Хорек CCT8/TCP1 theta Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаFG60078-ANRRBS16764
Хорек CCT8/TCP1 theta Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60078-CFRBS14711
Хорек CCT8/TCP1 theta Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60078-CHRBS14711
Хорек CCT8/TCP1 theta Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60078-CMRBS14711
Хорек CCT8/TCP1 theta Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60078-CYRBS14711
Хорек CCT8/TCP1 theta Джин клон кДНК в вектор клонированияFG60078-GRBS5132
Хорек CCT8/TCP1 theta Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60078-NFRBS14711
Хорек CCT8/TCP1 theta Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60078-NHRBS14711
Хорек CCT8/TCP1 theta Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60078-NMRBS14711
Хорек CCT8/TCP1 theta Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60078-NYRBS14711
Хорек CCT8/TCP1 theta Джин ORF экспрессии кДНК клона плазмидыFG60078-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: FG60078-NF
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.