Быстрый заказ

Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Хорек CAMK2G Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:XM_004769400.1
    Размер кДНК:1488bp
    Описание кДНК:Full length Clone DNA of Mustela putorius furo calcium>calmodulin-dependent protein kinase II gamma with C terminal His tag.
    Синоним гена:CAMK2G
    Виды:Ferret
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60160-ACGRBS15400
    Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60160-ACRRBS15400
    Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаFG60160-ANGRBS15400
    Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаFG60160-ANRRBS15400
    Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60160-CFRBS13340
    Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60160-CHRBS13340
    Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60160-CMRBS13340
    Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60160-CYRBS13340
    Хорек CaMKII/CAMK2G Джин клон кДНК в вектор клонированияFG60160-GRBS5130
    Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60160-NFRBS13340
    Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60160-NHRBS13340
    Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60160-NMRBS13340
    Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60160-NYRBS13340
    Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмидыFG60160-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: FG60160-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».