Быстрый заказ

Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Хорек CAMK2G Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_004769400.1
Размер кДНК:1488bp
Описание кДНК:Full length Clone DNA of Mustela putorius furo calcium>calmodulin-dependent protein kinase II gamma with C terminal HA tag.
Синоним гена:CAMK2G
Виды:Ferret
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60160-ACGRBS15400
Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60160-ACRRBS15400
Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаFG60160-ANGRBS15400
Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаFG60160-ANRRBS15400
Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60160-CFRBS13340
Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60160-CHRBS13340
Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60160-CMRBS13340
Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60160-CYRBS13340
Хорек CaMKII/CAMK2G Джин клон кДНК в вектор клонированияFG60160-GRBS5130
Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60160-NFRBS13340
Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60160-NHRBS13340
Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60160-NMRBS13340
Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60160-NYRBS13340
Хорек CaMKII/CAMK2G Джин ORF экспрессии кДНК клона плазмидыFG60160-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: FG60160-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».