Быстрый заказ

Хорек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Ferret CA2 Информация о продукте «Клон cDNA»
Размер кДНК:783bp
Описание кДНК:Full length Clone DNA of Mustela putorius furo (sub-species: furo) carbonic anhydrase II with C terminal Myc tag.
Синоним гена:CA2
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Хорек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Хорек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60084-ACGRBS15396
Хорек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60084-ACRRBS15396
Хорек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаFG60084-ANGRBS15396
Хорек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаFG60084-ANRRBS15396
Хорек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60084-CFRBS13343
Хорек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60084-CHRBS13343
Хорек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60084-CMRBS13343
Хорек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60084-CYRBS13343
Хорек Carbonic Anhydrase II Джин клон кДНК в вектор клонированияFG60084-GRBS5132
Хорек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60084-NFRBS13343
Хорек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60084-NHRBS13343
Хорек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60084-NMRBS13343
Хорек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60084-NYRBS13343
Хорек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмидыFG60084-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. Carbonic anhydrase II is one of fourteen forms of human α carbonic anhydrases. Defects in this enzyme are associated with osteopetrosis and renal tubular acidosis. Renal carbonic anhydrase allows the reabsorption of sodium ions in the proximal tubule. Carbonic anhydrase II has been shown to interact with Band 3 and Sodium-hydrogen antiporter 1.

  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Lilias A, et al. (1972) Crystal Structure of Human Carbonic Anhydrase C. Nature new biology. 235: 131-7.
  • Li XJ, et al. (2002) Carbonic Anhydrase II Binds to and Enhances Activity of the Na+/H+ Exchanger. The Journal of Biological Chemistry. 277: 36085-91.
  • Size / Price
    Каталог: FG60084-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.