Быстрый заказ

Хорек C1QA Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Ferret C1QA Информация о продукте «Клон cDNA»
Размер кДНК:738bp
Описание кДНК:Full length Clone DNA of Mustela putorius furo (sub-species: furo) complement component 1, q subcomponent, A chain with C terminal HA tag.
Синоним гена:C1QA
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Хорек C1QA Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Хорек C1QA Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60041-ACGRBS15400
Хорек C1QA Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60041-ACRRBS15400
Хорек C1QA Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаFG60041-ANGRBS15400
Хорек C1QA Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаFG60041-ANRRBS15400
Хорек C1QA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60041-CFRBS13340
Хорек C1QA Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60041-CHRBS13340
Хорек C1QA Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60041-CMRBS13340
Хорек C1QA Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60041-CYRBS13340
Хорек C1QA Джин клон кДНК в вектор клонированияFG60041-GRBS5130
Хорек C1QA Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60041-NFRBS13340
Хорек C1QA Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60041-NHRBS13340
Хорек C1QA Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60041-NMRBS13340
Хорек C1QA Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60041-NYRBS13340
Хорек C1QA Джин ORF экспрессии кДНК клона плазмидыFG60041-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.