Быстрый заказ

Text Size:AAA

Хорек Beta-2 microglobulin/B2M Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Ferret B2M Информация о продукте «Клон cDNA»
Размер кДНК:387bp
Описание кДНК:Full length Clone DNA of Mustela putorius furo (sub-species: furo) beta-2-microglobulin with C terminal Myc tag.
Синоним гена:B2M
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Хорек Beta-2 microglobulin/B2M Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Хорек Beta-2 microglobulin/B2M Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60069-ACGRBS15400
Хорек Beta-2 microglobulin/B2M Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60069-ACRRBS15400
Хорек Beta-2 microglobulin/B2M Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60069-CFRBS13340
Хорек Beta-2 microglobulin/B2M Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60069-CHRBS13340
Хорек Beta-2 microglobulin/B2M Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60069-CMRBS13340
Хорек Beta-2 microglobulin/B2M Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60069-CYRBS13340
Хорек Beta-2 microglobulin/B2M Джин клон кДНК в вектор клонированияFG60069-GRBS5130
Хорек Beta-2 microglobulin/B2M Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60069-NFRBS13340
Хорек Beta-2 microglobulin/B2M Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60069-NHRBS13340
Хорек Beta-2 microglobulin/B2M Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60069-NMRBS13340
Хорек Beta-2 microglobulin/B2M Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60069-NYRBS13340
Хорек Beta-2 microglobulin/B2M Джин ORF экспрессии кДНК клона плазмидыFG60069-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

B2M, also known as β2-Microglobulin or CDABP0092, is a component of MHC class I molecules found expression in all nucleated cells (excludes red blood cells). The major function of MHC class I moleculesis is to display fragments of proteins from within the cell to T-cells and cells containing foreign proteins will be attacked. B2M(β2-Microglobulin) is a low molecular weight protein. It was demonstrated that B2M(β2-Microglobulin) was localized in the membranes of nucleated cells and was found to be associated with HL-A antigens.B2M(β2- Microglobulin) is present in free form in various body fluids and as a subunit of histocompatibility antigens on cell surfaces lateral to theα3 chain. Unlikeα3, β2 has no transmembrane region. Directly above β2 lies the α1 chain, which itself is lateral to the α2. In the absence of B2M(β2 microglobulin), very limited amounts of MHC class I (classical and non-classical) molecules can be detected on the surface. In the absence of MHC class I, CD8 T cells, a subset of T cells involved in the development of acquired immunity cannot develop. Low levels of B2M(β2 microglobulin) can indicate non-progression of HIV.

  • Poulik MD, et al. (1979) Beta 2-Microglobulin: methods and clinical applications. CRC Ctit Rev Clin Lab Sci. 10(3): 225-45.
  • Poulik MD, et al. (1975) Beta2-Microglobulins. Contemp Top Mol Immunol. 4: 157-204.
  • Berggard I. (1976) Beta2-Microglobulins: isolation, properties, and distribution. Fed Proc. 35(5): 1167-70.
  • Size / Price
    Каталог: FG60069-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.