AP1M1 cDNA ORF Clone, Ferret, C-OFPSpark® tag

Price:
Size:
Number:

AP1M1 cDNA ORF Clone, Ferret, C-OFPSpark® tag: General Information

Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1272 bp
Description
Full length Clone DNA of Ferret adaptor-related protein complex 1, mu 1 subunit with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

AP1M1 Background Information

Full Name
adaptor related protein complex 1 mu 1 subunit
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait