After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Хорек Annexin A2/ANXA2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Ferret ANXA2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_004758782.1
Размер кДНК:1020bp
Описание кДНК:Full length Clone DNA of Mustela putorius furo (sub-species: furo) annexin A2 with N terminal Flag tag.
Синоним гена:ANXA2
Виды:Ferret
переносчик:pCMV3-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Хорек Annexin A2/ANXA2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Хорек Annexin A2/ANXA2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаFG60086-ACGRBS15400
Хорек Annexin A2/ANXA2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаFG60086-ACRRBS15400
Хорек Annexin A2/ANXA2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаFG60086-ANGRBS15400
Хорек Annexin A2/ANXA2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаFG60086-ANRRBS15400
Хорек Annexin A2/ANXA2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаFG60086-CFRBS13340
Хорек Annexin A2/ANXA2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаFG60086-CHRBS13340
Хорек Annexin A2/ANXA2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаFG60086-CMRBS13340
Хорек Annexin A2/ANXA2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаFG60086-CYRBS13340
Хорек Annexin A2/ANXA2 Джин клон кДНК в вектор клонированияFG60086-GRBS5130
Хорек Annexin A2/ANXA2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаFG60086-NFRBS13340
Хорек Annexin A2/ANXA2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаFG60086-NHRBS13340
Хорек Annexin A2/ANXA2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаFG60086-NMRBS13340
Хорек Annexin A2/ANXA2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаFG60086-NYRBS13340
Хорек Annexin A2/ANXA2 Джин ORF экспрессии кДНК клона плазмидыFG60086-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: FG60086-NF
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».