After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse FOLR1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:
Размер кДНК:
Описание кДНК:
Синоним гена:
Виды:
переносчик:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Shipping_carrier:
Склад:
Mouse FOLR1 Gene Plasmid Map
Mouse FOLR1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Мышь Folate Binding Белок/FOLR1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50573-ACGRBS15400
Мышь Folate Binding Белок/FOLR1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50573-ACRRBS15400
Мышь Folate Binding Белок/FOLR1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50573-CFRBS13340
Мышь Folate Binding Белок/FOLR1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50573-CHRBS13340
Мышь Folate Binding Белок/FOLR1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50573-CMRBS13340
Мышь Folate Binding Белок/FOLR1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50573-CYRBS13340
Мышь Folate Binding Белок/FOLR1 Джин клон кДНК в вектор клонированияMG50573-MRBS5130
Мышь Folate Binding Белок/FOLR1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50573-NFRBS13340
Мышь Folate Binding Белок/FOLR1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50573-NHRBS13340
Мышь Folate Binding Белок/FOLR1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50573-NMRBS13340
Мышь Folate Binding Белок/FOLR1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50573-NYRBS13340
Мышь Folate Binding Белок/FOLR1 Джин ORF экспрессии кДНК клона плазмидыMG50573-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Contact Us
Изображения
  • Mouse FOLR1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Недавно просмотренные товары
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».