After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ErbB2/HER2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:
Размер кДНК:
Описание кДНК:
Синоним гена:
Виды:
переносчик:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Shipping_carrier:
Склад:
Mouse ErbB2/HER2 Gene Plasmid Map
Mouse ERBB2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Мышь HER2/ERBB2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50714-ACGRBS25660
Мышь HER2/ERBB2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50714-ACRRBS25660
Мышь HER2/ERBB2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50714-CFRBS23610
Мышь HER2/ERBB2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50714-CHRBS23610
Мышь HER2/ERBB2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50714-CMRBS23610
Мышь HER2/ERBB2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50714-CYRBS23610
Мышь HER2/ERBB2 Джин клон кДНК в вектор клонированияMG50714-GRBS5130
Мышь HER2/ERBB2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50714-NFRBS23610
Мышь HER2/ERBB2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50714-NHRBS23610
Мышь HER2/ERBB2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50714-NMRBS23610
Мышь HER2/ERBB2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50714-NYRBS23610
Мышь HER2/ERBB2 Джин ORF экспрессии кДНК клона плазмидыMG50714-UTRBS23610
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Human epidermal growth factor receptor 2 (HER2), also known as ErbB2, NEU, and CD340, is a type I membrane glycoprotein, and belongs to the epidermal growth factor (EGF) receptor family. HER2 protein cannot bind growth factors due to the lacking of ligand binding domain of its own and autoinhibited constitutively. However, HER2 forms a heterodimer with other ligand-bound EGF receptor family members, therefore stabilizes ligand binding and enhances kinase-mediated activation of downstream molecules. HER2 plays a key role in development, cell proliferation and differentiation. HER2 gene has been reported to associate with malignancy and a poor prognosis in numerous carcinomas, including breast, prostate, ovarian, lung cancers and so on.

Ссылки
  • Krawczyk N, et al. (2009) HER2 status on persistent disseminated tumor cells after adjuvant therapy may differ from initial HER2 status on primary tumor. Anticancer Res. 29(10): 4019-24.
  • Contact Us
    Изображения
    • Mouse ERBB2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».