Быстрый заказ

Человек Erythropoietin/EPO Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек EPO Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:
    Размер кДНК:
    Описание кДНК:
    Синоним гена:
    Виды:Human
    переносчик:
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with NP_000790.2.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with EPO qPCR primers for gene expression analysis, HP102356 )
    Promoter:
    Application:
    Antibiotic in E.coli:
    Antibiotic in mammalian cell:
    Shipping_carrier:
    Склад:
    pCMV2-FLAG Vector Information
     
    Vector Name pCMV2-FLAG
    Vector Size 5592bp
    Vector Type Mammalian Expression Vector
    Expression Method Constiutive, Stable / Transient
    Promoter CMV
    Antibiotic Resistance Kanamycin
    Selection In Mammalian Cells Hygromycin
    Protein Tag FLAG
    Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)

    Schematic of pCMV2-FLAG Multiple Cloning Sites

    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Человек Erythropoietin/EPO Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10236-ACGRBS15400
    Человек Erythropoietin/EPO Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10236-ACRRBS15400
    Человек Erythropoietin/EPO Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10236-CFRBS13340
    Человек Erythropoietin/EPO Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10236-CHRBS13340
    Человек Erythropoietin/EPO Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10236-CMRBS13340
    Человек Erythropoietin/EPO Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10236-CYRBS13340
    Человек Erythropoietin/EPO Джин клон кДНК в вектор клонированияHG10236-MRBS5130
    Человек Erythropoietin/EPO Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10236-NFRBS13340
    Человек Erythropoietin/EPO Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10236-NHRBS13340
    Человек Erythropoietin/EPO Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10236-NMRBS13340
    Человек Erythropoietin/EPO Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10236-NYRBS13340
    Человек Erythropoietin/EPO Джин ORF экспрессии кДНК клона плазмидыHG10236-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Erythropoietin is a member of the EPO / TPO family. It is a secreted, glycosylated cytokine composed of four alpha helical bundles. Erythropoietin can be found in the plasma and regulates red cell production by promoting erythroid differentiation and initiating hemoglobin synthesis. It also has neuroprotective activity against a variety of potential brain injuries and antiapoptotic functions in several tissue types. Erythropoietin is the principal hormone involved in the regulation of erythrocyte differentiation and the maintenance of a physiological level of circulating erythrocyte mass. It is produced by kidney or liver of adult mammals and by liver of fetal or neonatal mammals. Genetic variation in erythropoietin is associated with susceptbility to microvascular complications of diabetes type 2. These are pathological conditions that develop in numerous tissues and organs as a consequence of diabetes mellitus. They include diabetic retinopathy, diabetic nephropathy leading to end-stage renal disease, and diabetic neuropathy. Diabetic retinopathy remains the major cause of new-onset blindness among diabetic adults. It is characterized by vascular permeability and increased tissue ischemia and angiogenesis. It has a longer circulating half-life in vivo. Erythropoietin is being much misused as a performance-enhancing drug in endurance athletes.

    Ссылки
  • Jelkmann W, et al. (2007) Erythropoietin after a century of research: younger than ever. Eur J Haematol. 78 (3):183-205.
  • Miyake T, et al. (1997) Purification of human erythropoietin. J Biol Chem. 252(15):5558-64.
  • Haroon ZA, et al. (2003) A novel role for erythropoietin during fibrin-induced wound-healing response. Am J Pathol. 163(3):993-1000.
  • Siren AL, et al. (2001) Erythropoietin prevents neuronal apoptosis after cerebral ischemia and metabolic stress. Proc Natl Acad Sci. 98(7):4044-9.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».