Быстрый заказ

ПаспортОбзорыСвязанные продуктыПротоколы
Человек ELF4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:
Размер кДНК:
Описание кДНК:
Синоним гена:
Виды:
переносчик:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Shipping_carrier:
Склад:
Человек ELF4 Gene Plasmid Map
Human ELF4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Datasheet & Documentation

Contact Us
    Недавно просмотренные товары
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».