Быстрый заказ

E. coli Enoyl-ACP Reductase/FABI Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    E. coli FABI Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:
    Размер кДНК:789bp
    Описание кДНК:Full length Clone DNA of Escherichia coli enoyl-[acyl-carrier-protein] reductase, NADH-dependent with C terminal HA tag.
    Синоним гена:envM
    Виды:E. coli
    переносчик:pCMV3-C-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    E. coli Enoyl-ACP Reductase/FABI Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    E. coli Enoyl-ACP Reductase/FABI Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаEG30001-ACGRBS15400
    E. coli Enoyl-ACP Reductase/FABI Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаEG30001-ACRRBS15400
    E. coli Enoyl-ACP Reductase/FABI Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаEG30001-ANGRBS15400
    E. coli Enoyl-ACP Reductase/FABI Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаEG30001-ANRRBS15400
    E. coli Enoyl-ACP Reductase/FABI Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаEG30001-CFRBS13340
    E. coli Enoyl-ACP Reductase/FABI Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаEG30001-CHRBS13340
    E. coli Enoyl-ACP Reductase/FABI Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаEG30001-CMRBS13340
    E. coli Enoyl-ACP Reductase/FABI Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаEG30001-CYRBS13340
    E. coli Enoyl-ACP Reductase/FABI Джин клон кДНК в вектор клонированияEG30001-MRBS5130
    E. coli Enoyl-ACP Reductase/FABI Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаEG30001-NFRBS13340
    E. coli Enoyl-ACP Reductase/FABI Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаEG30001-NHRBS13340
    E. coli Enoyl-ACP Reductase/FABI Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаEG30001-NMRBS13340
    E. coli Enoyl-ACP Reductase/FABI Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаEG30001-NYRBS13340
    E. coli Enoyl-ACP Reductase/FABI Джин ORF экспрессии кДНК клона плазмидыEG30001-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Enoyl-ACP reductase, also known as NADH-dependent enoyl-ACP reductase and FABI, is a cell inner membrane and peripheral membrane protein which belongs to the short-chain dehydrogenases/reductases (SDR) family and FabI subfamily. Microorganisms produce many kinds of antibiotics which function in an antagonistic capacity in nature where they have much competition. Bacterial FAS provides essential fatty acids for use in the assembly of key cellular components. Among them, FABI is an enoyl-ACP reductase which catalyzes the final and rate-limiting step of bacterial FAS. The antibiotic diazaborine interferes with the activity by binding to the protein. FABI is a potential target for selective antibacterial action, because it shows low overall sequence homology with mammalian enzymes. Various compounds have been reported as inhibitors of bacterial FabI-inhibitory compounds.

    Ссылки
  • Miller, WH. et al., 2002, J Med Chem  45 (15):3246-56. 
  • Kitagawa, H. et al., 2007, Bioorg Med Chem  15 (2):1106-16.
  • Zheng, C.J. et al., 2007, Biochem Biophys Res Commun 362 (4):1107-12.
  • Lu,H. et al., 2008, Acc Chem Res 41 (1):11-20.
  • Zheng,CJ. et al., 2009, J Antimicrob Chemother 63 (5):949-53.
  • Size / Price
    Каталог: EG30001-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».