Быстрый заказ

Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
DENV DENV-NS5A Информация о продукте «Клон cDNA»
Размер кДНК:2700bp
Описание кДНК:Full length Clone DNA of DENV-2 (strain New Guinea C) NS5A with C terminal HA tag.
Синоним гена:DENV-NS5A
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence AF038403.1 (7570..10269), corresponding to amino acid sequence AAC59275.1 (aa 2492-3391).
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, C-HA Метка on other vectors
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, C-GFPSpark МеткаVG40267-ACGRBS29080
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG40267-ACRRBS29080
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, N-GFPSpark МеткаVG40267-ANGRBS29080
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, N-OFPSpark / RFP МеткаVG40267-ANRRBS29080
Dengue virus DENV-2 (strain New Guinea C) NS5A Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40267-CFRBS27030
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, C-His МеткаVG40267-CHRBS27030
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, C-Myc МеткаVG40267-CMRBS27030
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, C-HA МеткаVG40267-CYRBS27030
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid (Codon Optimized)VG40267-GRBS9920
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, N-Flag МеткаVG40267-NFRBS27030
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, N-His МеткаVG40267-NHRBS27030
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, N-Myc МеткаVG40267-NMRBS27030
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, N-HA МеткаVG40267-NYRBS27030
Dengue virus DENV-2 (strain New Guinea C) NS5A natural ORF mammalian expression plasmidVG40267-UTRBS27030
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: VG40267-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.