Быстрый заказ

Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    DENV DENV-NS4B Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:AF038403.1
    Размер кДНК:744bp
    Описание кДНК:Full length Clone DNA of DENV-2 (strain New Guinea C) NS4B with C terminal HA tag.
    Синоним гена:DENV-NS4B
    Виды:DENV
    переносчик:pCMV3-C-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:Identical with the Gene Bank Ref. ID sequence AF038403.1 (6826..7569), corresponding to amino acid sequence AAC59275.1 (aa 2244-2491).
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, C-HA Метка on other vectors
    Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, C-GFPSpark МеткаVG40266-ACGRBS22240
    Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG40266-ACRRBS22240
    Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, N-GFPSpark МеткаVG40266-ANGRBS22240
    Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, N-OFPSpark / RFP МеткаVG40266-ANRRBS22240
    Dengue virus DENV-2 (strain New Guinea C) NS4B Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40266-CFRBS20190
    Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, C-His МеткаVG40266-CHRBS20190
    Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, C-Myc МеткаVG40266-CMRBS20190
    Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, C-HA МеткаVG40266-CYRBS20190
    Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid (Codon Optimized)VG40266-GRBS6500
    Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, N-Flag МеткаVG40266-NFRBS20190
    Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, N-His МеткаVG40266-NHRBS20190
    Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, N-Myc МеткаVG40266-NMRBS20190
    Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, N-HA МеткаVG40266-NYRBS20190
    Dengue virus DENV-2 (strain New Guinea C) NS4B natural ORF mammalian expression plasmidVG40266-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: VG40266-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».