After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
DENV DENV-NS4A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:AF038403.1
Размер кДНК:381bp
Описание кДНК:Full length Clone DNA of DENV-2 (strain New Guinea C) NS4A with C terminal HA tag.
Синоним гена:DENV-NS4A
Виды:DENV
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence AF038403.1 (6376..6756), corresponding to amino acid sequence AAC59275.1 (aa 2094-2220).
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, C-HA Метка on other vectors
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, C-GFPSpark МеткаVG40265-ACGRBS22240
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG40265-ACRRBS22240
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, N-GFPSpark МеткаVG40265-ANGRBS22240
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, N-OFPSpark / RFP МеткаVG40265-ANRRBS22240
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, C-Flag МеткаVG40265-CFRBS20190
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, C-His МеткаVG40265-CHRBS20190
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, C-Myc МеткаVG40265-CMRBS20190
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, C-HA МеткаVG40265-CYRBS20190
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid (Codon Optimized)VG40265-GRBS6500
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, N-Flag МеткаVG40265-NFRBS20190
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, N-His МеткаVG40265-NHRBS20190
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, N-Myc МеткаVG40265-NMRBS20190
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, N-HA МеткаVG40265-NYRBS20190
Dengue virus DENV-2 (strain New Guinea C) NS4A natural ORF mammalian expression plasmidVG40265-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: VG40265-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».