After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Яванский макак ZFP62 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus ZFP62 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005558821.1
Размер кДНК:2715bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ZFP62 zinc finger protein with C terminal His tag.
Синоним гена:ZFP62
Виды:Cynomolgus
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Яванский макак ZFP62 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Яванский макак ZFP62 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90824-ACGRBS22240
Яванский макак ZFP62 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90824-ACRRBS22240
Яванский макак ZFP62 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90824-ANGRBS22240
Яванский макак ZFP62 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90824-ANRRBS22240
Яванский макак ZFP62 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90824-CFRBS20190
Яванский макак ZFP62 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90824-CHRBS20190
Яванский макак ZFP62 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90824-CMRBS20190
Яванский макак ZFP62 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90824-CYRBS20190
Яванский макак ZFP62 Джин клон кДНК в вектор клонированияCG90824-GRBS5130
Яванский макак ZFP62 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90824-NFRBS20190
Яванский макак ZFP62 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90824-NHRBS20190
Яванский макак ZFP62 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90824-NMRBS20190
Яванский макак ZFP62 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90824-NYRBS20190
Яванский макак ZFP62 Джин ORF экспрессии кДНК клона плазмидыCG90824-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90824-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».