After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Резус-фактор 14-3-3 beta/YWHAB Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus YWHAB Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_001109676.2
Размер кДНК:735bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide with N terminal Myc tag.
Синоним гена:YWHAB
Виды:Rhesus
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор 14-3-3 beta/YWHAB Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Резус-фактор 14-3-3 beta/YWHAB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90022-ACGRBS15400
Резус-фактор 14-3-3 beta/YWHAB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90022-ACRRBS15400
Резус-фактор 14-3-3 beta/YWHAB Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90022-ANGRBS15400
Резус-фактор 14-3-3 beta/YWHAB Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90022-ANRRBS15400
Резус-фактор 14-3-3 beta/YWHAB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90022-CFRBS13340
Резус-фактор 14-3-3 beta/YWHAB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90022-CHRBS13340
Резус-фактор 14-3-3 beta/YWHAB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90022-CMRBS13340
Резус-фактор 14-3-3 beta/YWHAB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90022-CYRBS13340
Резус-фактор 14-3-3 beta/YWHAB Джин клон кДНК в вектор клонированияCG90022-GRBS5130
Резус-фактор 14-3-3 beta/YWHAB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90022-NFRBS13340
Резус-фактор 14-3-3 beta/YWHAB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90022-NHRBS13340
Резус-фактор 14-3-3 beta/YWHAB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90022-NMRBS13340
Резус-фактор 14-3-3 beta/YWHAB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90022-NYRBS13340
Резус-фактор 14-3-3 beta/YWHAB Джин ORF экспрессии кДНК клона плазмидыCG90022-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

14-3-3 beta / YWHAB is a member of the 14-3-3 proteins family. 14-3-3 proteins are a group of highly conserved proteins that are involved in many vital cellular processes such as metabolism, protein trafficking, signal transduction, apoptosis and cell cycle regulation. 14-3-3 proteins are mainly localized in the synapses and neuronal cytoplasm, and seven isoforms have been identified in mammals. This family of proteins was initially identified as adaptor proteins which bind to phosphoserine-containing motifs. Binding motifs and potential functions of 14-3-3 proteins are now recognized to have a wide range of functional relevance. 14-3-3 beta / YWHAB is found in both plants and mammals, and this protein is 100% identical to the mouse ortholog. 14-3-3 beta / YWHAB interacts with CDC25 phosphatases, RAF1 and IRS1 proteins, suggesting its role in diverse biochemical activities related to signal transduction, such as cell division and regulation of insulin sensitivity. 14-3-3 beta / YWHAB has also been implicated in the pathogenesis of small cell lung cancer. 14-3-3 beta / YWHAB binding negatively regulates RSK1 activity to maintain signal specificity and that association/dissociation of the 14-3-3beta-RSK1 complex is likely to be important for mitogen-mediated RSK1 activation.

Ссылки
  • Tommerup N, et al. (1996) Assignment of the human genes encoding 14,3-3 Eta (YWHAH) to 22q12, 14-3-3 zeta (YWHAZ) to 2p25.1-p25.2, and 14-3-3 beta (YWHAB) to 20q13.1 by in situ hybridization. Genomics. 33(1): 149-50.
  • Jin YH, et al. (2008) Sirt2 interacts with 14-3-3 beta/gamma and down-regulates the activity of p53. Biochem Biophys Res Commun. 368(3): 690-5.
  • Sekimoto T, et al. (2004) 14-3-3 suppresses the nuclear localization of threonine 157-phosphorylated p27(Kip1). EMBO J. 23(9): 1934-42.
  • Size / Price
    Каталог: CG90022-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».