After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор YIPF3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus YIPF3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001260624.1
Размер кДНК:1053bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) Yip1 domain family, member 3 with C terminal His tag.
Синоним гена:YIPF3
Виды:Rhesus
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Резус-фактор YIPF3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Резус-фактор YIPF3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90349-ACGRBS15400
Резус-фактор YIPF3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90349-ACRRBS15400
Резус-фактор YIPF3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90349-CFRBS13340
Резус-фактор YIPF3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90349-CHRBS13340
Резус-фактор YIPF3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90349-CMRBS13340
Резус-фактор YIPF3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90349-CYRBS13340
Резус-фактор YIPF3 Джин клон кДНК в вектор клонированияCG90349-GRBS5130
Резус-фактор YIPF3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90349-NFRBS13340
Резус-фактор YIPF3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90349-NHRBS13340
Резус-фактор YIPF3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90349-NMRBS13340
Резус-фактор YIPF3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90349-NYRBS13340
Резус-фактор YIPF3 Джин ORF экспрессии кДНК клона плазмидыCG90349-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90349-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».