Быстрый заказ

Яванский макак WDPCP Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак WDPCP Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:XM_005575758.1
    Размер кДНК:2127bp
    Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) WD repeat containing planar cell polarity effector with C terminal His tag.
    Синоним гена:WDPCP
    Виды:Cynomolgus
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Яванский макак WDPCP Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Яванский макак WDPCP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90347-ACGRBS16760
    Яванский макак WDPCP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90347-ACRRBS16760
    Яванский макак WDPCP Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90347-ANGRBS16760
    Яванский макак WDPCP Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90347-ANRRBS16760
    Яванский макак WDPCP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90347-CFRBS14710
    Яванский макак WDPCP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90347-CHRBS14710
    Яванский макак WDPCP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90347-CMRBS14710
    Яванский макак WDPCP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90347-CYRBS14710
    Яванский макак WDPCP Джин клон кДНК в вектор клонированияCG90347-GRBS5130
    Яванский макак WDPCP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90347-NFRBS14710
    Яванский макак WDPCP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90347-NHRBS14710
    Яванский макак WDPCP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90347-NMRBS14710
    Яванский макак WDPCP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90347-NYRBS14710
    Яванский макак WDPCP Джин ORF экспрессии кДНК клона плазмидыCG90347-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».